histograms graphpad prism v. 9.4.0 (673) Search Results


version (build) 10.8.1  (Becton Dickinson)
90
Becton Dickinson version (build) 10.8.1
Version (Build) 10.8.1, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/histograms+graphpad+prism+v%2E+9%2E4%2E0+(673)/version++build++10+8+1/pmc09760606__BSR___2022___2185_supp-49-7-14
Average 90 stars, based on 1 article reviews
version (build) 10.8.1 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
mouse  (Jackson Laboratory)
86
Jackson Laboratory mouse
Key resources table
Mouse, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/histograms+graphpad+prism+v%2E+9%2E4%2E0+(673)/6+c57bl+mouse/pmc10113827-339-160-161
Average 86 stars, based on 1 article reviews
mouse - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier
a32849 donkey anti chicken igg alexafluor 488 jackson immuno research laboratories  (Jackson Immuno)
96
Jackson Immuno a32849 donkey anti chicken igg alexafluor 488 jackson immuno research laboratories
Key resources table
A32849 Donkey Anti Chicken Igg Alexafluor 488 Jackson Immuno Research Laboratories, supplied by Jackson Immuno, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/histograms+graphpad+prism+v%2E+9%2E4%2E0+(673)/Alexa+Fluor+488+AffiniPure+Donkey+Anti-Chicken+IgY/pmc10113827-339-112-117
Average 96 stars, based on 1 article reviews
a32849 donkey anti chicken igg alexafluor 488 jackson immuno research laboratories - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

Image Search Results


Key resources table

Journal: iScience

Article Title: LRIT3 expression in cone photoreceptors restores post-synaptic bipolar cell signalplex assembly and partial function in Lrit3 −/− mice

doi: 10.1016/j.isci.2023.106499

Figure Lengend Snippet: Key resources table

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Guinea pig anti-LRIT3 Ronald Gregg; Hasan et al. 10 N/A Rabbit anti-TRPM1 Ronald Gregg; Hasan et al. 10 N/A Goat anti-mGluR6 Ronald Gregg; This paper N/A Sheep anti-GPR179 Ronald Gregg; Peachey et al. 19 N/A Rabbit anti-mCAR Sheryl Craft, Zhu et al. 41 N/A Chicken anti-GFP Invitrogen Cat# A10262 Sheep anti-RGS11 Kiril Martemyanov; Cao et al. 42 N/A Rabbit anti-ELFN2 Invitrogen Cat# PA5-43521 PNA Molecular Probes Cat# L-32460 Donkey anti-sheep IgG-AlexaFluor 488 Life Technologies Cat# A111015 Donkey anti-rabbit IgG-AlexaFluor 647 Life Technologies Cat# A31573 Donkey anti-guinea pig IgG-Cy3 Millipore Cat# AP193C Donkey anti-rabbit IgG-AlexaFluor 488 Life Technologies Cat# A21206 Donkey anti-goat IgG-AlexaFluor 647 Life Technologies Cat# A32849 Donkey anti-chicken IgG-AlexaFluor 488 Jackson Immuno Research Laboratories Cat# 703-545-155;RRID: AB_2340375 Bacterial and virus strains pAAV-Gnat2::Lrit3 Ronald Gregg; This paper N/A rAAV8 capsid Vigene Biosciences N/A Critical commercial assays In-Fusion® HD Cloning Plus Takara Cat # 638910 Experimental models: Organisms/strains Mouse: Lrit3 em1Rgg Ronald Gregg MGI: 5645054 Mouse:C57Bl6/J Jackson Labs Stock # 000664; RRID:IMSR_JAX:000664 Oligonucleotides Lrit3 KO genotyping forward CTTTAAACGGAGTCTCGAAGC N/A Lrit3 KO genotyping reverse CTGACCGCCTCGTTTGGCAC N/A Recombinant DNA Plasmid Gnat2::Lrit3 This paper N/A Software and algorithms Prism 9.4.0 (673) Graphpad Software RRID: SCR_002798 MC_Rack 4.6.2 Multi Channel System RRID: SCR_014955 Offline Sorter 3.3.5 Plexon Inc RRID: SCR_000012 NeuroExplorer 5.103 Nex Technologies RRID: SCR_001818 Fluoview Olympus RRID: SCR_017015 Open in a separate window Key resources table .

Techniques: CRAfT Assay, Virus, Cloning, Recombinant, Plasmid Preparation, Software

Key resources table

Journal: iScience

Article Title: LRIT3 expression in cone photoreceptors restores post-synaptic bipolar cell signalplex assembly and partial function in Lrit3 −/− mice

doi: 10.1016/j.isci.2023.106499

Figure Lengend Snippet: Key resources table

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Guinea pig anti-LRIT3 Ronald Gregg; Hasan et al. 10 N/A Rabbit anti-TRPM1 Ronald Gregg; Hasan et al. 10 N/A Goat anti-mGluR6 Ronald Gregg; This paper N/A Sheep anti-GPR179 Ronald Gregg; Peachey et al. 19 N/A Rabbit anti-mCAR Sheryl Craft, Zhu et al. 41 N/A Chicken anti-GFP Invitrogen Cat# A10262 Sheep anti-RGS11 Kiril Martemyanov; Cao et al. 42 N/A Rabbit anti-ELFN2 Invitrogen Cat# PA5-43521 PNA Molecular Probes Cat# L-32460 Donkey anti-sheep IgG-AlexaFluor 488 Life Technologies Cat# A111015 Donkey anti-rabbit IgG-AlexaFluor 647 Life Technologies Cat# A31573 Donkey anti-guinea pig IgG-Cy3 Millipore Cat# AP193C Donkey anti-rabbit IgG-AlexaFluor 488 Life Technologies Cat# A21206 Donkey anti-goat IgG-AlexaFluor 647 Life Technologies Cat# A32849 Donkey anti-chicken IgG-AlexaFluor 488 Jackson Immuno Research Laboratories Cat# 703-545-155;RRID: AB_2340375 Bacterial and virus strains pAAV-Gnat2::Lrit3 Ronald Gregg; This paper N/A rAAV8 capsid Vigene Biosciences N/A Critical commercial assays In-Fusion® HD Cloning Plus Takara Cat # 638910 Experimental models: Organisms/strains Mouse: Lrit3 em1Rgg Ronald Gregg MGI: 5645054 Mouse:C57Bl6/J Jackson Labs Stock # 000664; RRID:IMSR_JAX:000664 Oligonucleotides Lrit3 KO genotyping forward CTTTAAACGGAGTCTCGAAGC N/A Lrit3 KO genotyping reverse CTGACCGCCTCGTTTGGCAC N/A Recombinant DNA Plasmid Gnat2::Lrit3 This paper N/A Software and algorithms Prism 9.4.0 (673) Graphpad Software RRID: SCR_002798 MC_Rack 4.6.2 Multi Channel System RRID: SCR_014955 Offline Sorter 3.3.5 Plexon Inc RRID: SCR_000012 NeuroExplorer 5.103 Nex Technologies RRID: SCR_001818 Fluoview Olympus RRID: SCR_017015 Open in a separate window Key resources table .

Techniques: CRAfT Assay, Virus, Cloning, Recombinant, Plasmid Preparation, Software